gisellem95 gisellem95

16-05-2024
Spanish

Answered

Escoge la opción correcta. Las personas votan más _____. cuando el sufragio es obligatorio cuando tienen más educación y compromiso político cuando el sufragio es voluntario y gratuito cuando hay elecciones en un día feriado

Answer :

Other Questions

What education changes came from the enactment of the Rehabilitation Act of 1973?

RESEARCH TOPICThe Challenges of Addressing Gender Inequality in the Public Sector of South Africa: A case study of the Department of Public Service and Administ

To rewrite this for better readability and correct any possible issues, I will clarify the task associated with the given expression.---Evaluate the expression:

What is an approximate solution to this equation? 4/x-5= √x 3 2

Which of the following secondary sexual characteristics are stimulated by testosterone?A Growth of beardB Hoarse voiceC High pitched voiceD Broadening of should

Does Oxford University have a particle accelerator?

For which of the following reasons might a child refuse to go to school? a. School phobia b. Separation anxiety c. Social phobiad. All of the above

The Gunflint Chert contains an extensive but diverse collection of ___________a. Acritarchsb. Eukaryotes photosynthetic organismsc. Prokaryotes photosynthetic o

If [tex]\( a + b + c = 0 \)[/tex], then what is the value of [tex]\( (a+b)(b+d)(c+1) \)[/tex]?

Find the zeros and give the multiplicity of each for f(x)=x⁶+2x⁵-24x⁴ . One zero is x=____ and has a multiplicity of ___

What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic

who fought against each other in the crusades?

What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7

Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?

which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5

What statement best describes a republic?

4(3-5)=-2(8-z)-6z what is z

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

how to i do 7/16÷(31/2÷1/2)

In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front