ematthewsjr388 ematthewsjr388

08-06-2024
Health

Answered

50-vear-old female with a medical history of diabetes is being evaluated for an annual exam. She has no current complaints and feels well. She does not smoke. Which of the following is the next best step for CVD prevention in this patient?
A. Begin statin
B. Calculate the 10-year (ASCVD) risk
C. Begin antihypertensive therapy
D. Repeat the lipid levels in 3 years
E. Calculate the 30)ear (ASCVD) risk

Answer :

Other Questions

The hypotenuse of a [tex]45^{\circ}-45^{\circ}-90^{\circ}[/tex] triangle measures 4 cm. What is the length of one leg of the triangle?A. [tex]2 \, \text{cm}[/te

A hotel offers a reward program based on the number of nights stayed. The function f(x) represents the number of free nights earned as a function of x, the numb

After rectification by a full-wave bridge rectifier, how do you determine the average DC value before filtering?

The function [tex]$g$[/tex] is defined by [tex]$g(x)=\frac{1}{3x-7}$[/tex], and [tex][tex]$g(b)=20$[/tex][/tex], where [tex]$b$[/tex] is a constant. What is the

Which energy source has been developed and improved by chemists? wind coal batter

If 0.80 moles of acetic acid are allowed to react with 0.65 moles of sodium bicarbonate, what is the limiting reactant? How many moles of CO2 can be produced?

Explain one behavior that you have learned or taught through classical conditioning. In this essay, be sure that you identify and label the Neutral stimulus, t

What types of degrees are offered at Broward College? (Choose all that apply.)A. Associates in Arts B. Bachelor's C. Master's D. Associates in Science

What is a web page that serves as a publicly accessible personal journal and online forum for an individual or organization?A. An app B. A blog C. Web 3.0 D.

Which graph shows the solution to the following system? 2x + 5y = –6 x – 2y = –3

Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites

how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?

the bombing of Hiroshima and Nagasaki resulted in

How has water influenced the development of civilization in Africa

Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.

The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe

a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number

In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front