rachealwood1992 rachealwood1992

24-06-2024
Biology

Answered

4) Using the following RNA sequence, determine the correct sequence of amino acids using the codon chart found in the
text/notes (Hint: Think mRNA and the start codon).
AACGAUGAUUGGUCGUUCCUGAAAG

Answer :

Other Questions

a car the same type and make is 3 1/2 year old car. eastamate the value of the car

I understood, too, that in ordinary civil administration this oath even forbade me to practically indulge my primary abstract judgment on the moral question of

The number of students who are enrolled in math classes at a local college can be represented by E = −16w + 550, where E represents the math class enrollment

Why is concentration so important in archery?

please help!! marine biology

23 green gumballs,52 red gumballs,34 blue gumball,61 yellow gumballs, and 30 pink gumballs. What percentage of gumballs are red?

Find [tex]\( c \)[/tex], the total of the payments, and the monthly payment. Choose the correct answers.[tex]\[ \operatorname{Interest}(I) = \frac{2 y c}{m(n+1)

Which of the following statements is correct?Select one:a. [tex]\(\left(-2^3, -2^3\right)\)[/tex] is located in the first quadrant.b. If [tex]\(a \ \textless \

For a crime to be committed, the prosecutor must be able to prove a criminal intent and an overt act to carry out that intent. Jack and Carolina agreed to rob a

A container holds 6.4 moles of gas. Hydrogen gas makes up [tex]25 \%[/tex] of the total moles in the container. If the total pressure is [tex]1.24 \, \text{atm}

The atmosphere contains about 80% nitrogen gas, but nitrogen in this form cannot be used by plants. Which process converts atmospheric nitrogen to a useful

Number 23 please show me how to do it and the answer

Contrast inference and prediction.

A speech on "books are the best companions".

what type of mammal is a peccary is it a marsupial, monotreme or a placental

Why can a constellation X not be seen in the summer, but only in winter?

Using an example, explain how small atoms are.

If a leaf branch of a healthy potted plant is covered a polythene bag tiny water droplets are seen .why does this happen ? Which part of the leaf is responsible

Which statement is always true for a square, but not always true for a rhombus? - Two angles are obtuse. - All sides are equal. - Two or more angles are ri

What if a wave reaches a type of matter it cannot pass through? Does it just stop moving? If not, where does it go?