lunaestcc lunaestcc

03-07-2024
Chemistry

Answered

H3PO4(aq) 3KOH(aq) ( 3H2O(l) K3PO4(aq) Using the equation above, what is the molarity of the H3PO4 solution if 17.3 mL requires 25.0 mL of 0.623 M KOH to neutralize?

Answer :

Other Questions

When you try to fit information into your existing schema, that is called:a) Accommodationb) Assimilationc) Equilibriumd) Adaptation

8. A gang member's need for closeness and a sense of belonging corresponds to which gang membership reason?A. Excitement B. Protection C. Companionship D. Vi

Considering the previous problem, did you get the same estimates of elasticity for the two changes in price (from $2 to $6 per hour; and from $4 to $9 per hour)

Christine is an obese 12-year-old. What is one prediction about her health as an adult that cannot be made?

According to Crystal, the majority of people in the world grow up in monolingual environments (i. E., places where only one language is spoken).a. Trueb. False

Mmathematics question for class 9

What same four letter word, fits in front of, Fill Locked Mass

What are the potential causes of a crunching sound in the knee when bending?

Drag the labels to the correct locations. Not all labels will be used.Calculate the mean and median of each data set, and determine what type of distribution it

I need help with this question about probability.

explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe

4.2meters= how many centimeter

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup

Can someone answer my question plz!!!! It's in the picture and show your work!!!!!

Which word has the long e sound? a. client b. inferior c. beautiful d. poetic

the bombing of Hiroshima and Nagasaki resulted in

what's the percentage of 1/8 ?

The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y