CLAYTAJHA46421 CLAYTAJHA46421

04-07-2024
Biology

Answered

The following is a short sequence of dsDNA within Gene X, indicated above with the dashed rectangle. Transcribe the DNA into the appropriate mRNA. Write the RNA in the 5' to 3' direction and do not include spaces. 5' ATCGGGCTACGGGTAACGCTGATTTACG 3' 3' TAGCCCGATGCCCATTGCGACTAAATGC 5'

The mRNA transcribed above will have what modification added to the 5' end? The 3' end?

Answer :

Other Questions

The minimal unit of sound that can make a difference in meaning, but that does not carry meaning itself (such as /b/ in bit or /p/ in pit) is:a. Syntax.b. A lan

Sea stars have a body cavity completely lined with tissue derived from mesoderm tissue. This makes themA. Acoelomates.B. Coelomates.C. Physiocoelomates.D. Pseud

Usually, a higher inventory turnover is preferred to a lower inventory turnover. However, an inventory turnover that is too high could mean:a. Business is too s

Question 1 (1 point) Given: g ∥ h and ∠2 ≅ ∠3 Prove: e ∥ f Horizontal and parallel lines e and f are intersected by diagonal and parallel lines g and h. At the

An airplane flies at a constant altitude of 1200 m and a constant speed of 80 m/s when a 7.0 kg bowling ball falls out of the cargo hold. What is the speed of t

Find the value of a

Fungi are made of hyphae that interwine to form a network called?

A distribution of values is normal with a mean of 239.5 and a standard deviation of 27.Find the probability that a randomly selected value is greater than 258.4

An organization through which members jointly make decisions about prices and production is:A) None of the aboveB) a monarchical oligarchyC) a cartelD) perfect

Question 39 of 40What key steps are involved in Business Benefits Realization?1. Needs Assessment2. Create Business Case3. Elicit and Analyze Requirements4. Bui

A car dealership lowered all of its car prices by 15%. what was the original price of a car now priced at £9500

Write the next two terms in the sequence I really need help thanks

Steve's scores on Exams #1, #2 and #4 are 89, 93, and 87 (out 0f 100). Unfortunately he skipped Exam #3. This resulted in a score of 0 for him on Exam #3. If he

What do these two conditions have in common: webbed fingers and toes in humans and the development of cancer cells? A. Both are caused by excessive cell growt

Could someone please help me solve 8y-9=7/2Y

Were is the adverb in: Mrs.Simonson is in her office today

need help with the question in the picture

Anneke's science class measured 10 inches of rainfall during the month of May what was the average rainfall per day?(Round your answer to the nearest hundredth

Yvonne has gained a reputation for her cheesecakes. She takes orders for 10 cheesecakes and spends 8.5 hours on one Saturday baking them all. She earns $120 fr

find the equation of the line that passes through P(7,20) and Q the midpoint of R (-3,5) and S (5,11)