anisanooshiravan anisanooshiravan

20-06-2024
English

Answered

Read the following sentences and choose the best answer.

Your job ___ be very demanding, but at least it isn't boring.

a. may
b. must
c. has to
d. ought to

Answer :

GinnyAnswer GinnyAnswer

20-06-2024

Final answer:

Explanation of deontic modal hierarchy and examples of modal usage in different contexts.

Explanation:

Deontic modal strength hierarchy:

must/have to > should/ought to > may/might/could

Examples of modal usage:

Arnold must not recognize me.
Henry ought to be in his office by now.
George should be working late tonight.

Epistemic vs. deontic modality:

For each sentence, describe contexts where modals have epistemic or deontic readings.

Learn more about Modal verbs here:

https://brainly.com/question/44052204

Answer Link

Other Questions

(b) Arrange [tex]54\%, \frac{4}{5}, 1 \frac{1}{4}, 0.72[/tex] in ascending and descending order of magnitude.

Which of the following most accurately describes ABC’s initial hypothesis in addressing the client’s problem?a. More aggressive M&Asb. Optimize the product

Why is ongoing CRM software online training important for businesses?

The mechanical properties of wrought products are --------------- cast products a) better than b) less than c) the same as d) a, b, and c

For most firms the primary reason for holding cash is the _____ motive. a. Compensatingb. Balance c. Transactionald. Precautionary

Which of the following is an overstimulated person likely to be preoccupied with? (Check all that apply.) Multiple select question. a. Figuring out how his or h

**Question:**Which condition involves degenerative changes in the lumbar region without affecting the spinal cord (myelopathy) or spinal nerve roots (radiculopa

Madeline is 9 years old and considered obese. While her parents acknowledge that they could adopt a healthier lifestyle, they blame genetics for her weight prob

Glandular secretions that include portions of the cell occur in ....... Glands.A) holocrine B) merocrine C) endocrine D) apocrine

Question 2 (Multiple Choice Worth 2 points)Which of the following is true about sources of stress?A. They vary based on age and location.B. They are stable acro

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Compliant is to stubborn as excited is to

Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based

as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash

Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l

a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.

On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor

Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.

Compliant is to stubborn as excited is to

How has water influenced the development of civilization in Africa